Alpha Conotoxin Peptides (N01093) Nucleic Acid Card

General Information
Name Alpha Conotoxin Peptides
Organism Conus purpurascens
Organism Diet piscivorous
Organism Clade III
Organism Region Eastern Pacific
Notes

Sequence
atgttcaccgtgtttctgttggttgtcttggtaaccaccg
tcgtttccttcaattcagatcgtgcattaggtggcaggaa
tgctgcagccaaagcgtctgacaagatcgcttcgatcctc
gggagaagagcatgctgttcttatcctccctgtaacgtga
actatccagaaatttgtggtggacgaggc
tgatgctccag
gaccctctgaaccacgacgt
Sequence translation MFTVFLLVVLVTTVVSFNSDRALGGRNAAAKASDKIASIL
GRRACCSYPPCNVNYPEICGGRG

References
Olivera,B.M., Layer,R.T., Watkins,M., Hillyard,D.R., Mcintosh,M.J., Jones,R.M. and Schoenfeld,R. (2003) Alpha Conotoxin Peptides JP 2003525582-A 3 02-SEP-2003

Internal links
Proteins Encoded P1.10 precursor

External links
Ncbi
GenBank BD394993

Tools