Conus catus CcatH_1i_4 four-loop conotoxin precursor, gene, partial cds (N01101) Nucleic Acid Card

General Information
Name Conus catus CcatH_1i_4 four-loop conotoxin precursor, gene, partial cds
Organism Conus catus
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
t
gtggtgatcgtcgccgtgctgctcctgacggcctgtcaa
ctcatcacagctaatgactccagaagtacgcagaagcatc
gtgccctgaggtcggacaccaaactctccatgtcgactcg
ctgcaagggtaaaggagcatcatgtcgtaggacttcgtat
gactgctgcaccggttcttgcagatcaggtagatgtggc
t
gatccagcgcctgatctcccccttctgtgctctatccttt
tctg
Sequence translation VVIVAVLLLTACQLITANDSRSTQKHRALRSDTKLSMSTR
CKGKGASCRRTSYDCCTGSCRSGRCG

References
Duda,T.F. and Palumbi,S.R. (0) Molecular evolution of four-loop conotoxin precursors from fish-eating Conus

Internal links
Proteins Encoded CVIE precursor

External links
Ncbi
GenBank AF174217

Tools