Conus catus CcatH_2_1 four-loop conotoxin precursor, gene, partial cds (N01114) Nucleic Acid Card

General Information
Name Conus catus CcatH_2_1 four-loop conotoxin precursor, gene, partial cds
Organism Conus catus
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
t
gtggtgatcgtcgccgtgctgctcctgacggcctgtcaa
ctcatcacagctaatgactccagaggtacgcagaagcatc
gtgccctgaggtcggacaccaaactctccatgtcgactcg
ctgccagggtagaggagcatcatgtcgtaagactatgtat
aactgctgcagcggttcttgcaacagaggtagatgtggc
t
gatccggcgcctgatcttcccccttctgtgctctatcctt
ttctg
Sequence translation VVIVAVLLLTACQLITANDSRGTQKHRALRSDTKLSMSTR
CQGRGASCRKTMYNCCSGSCNRGRCG

References
Duda,T.F. and Palumbi,S.R. (0) Molecular evolution of four-loop conotoxin precursors from fish-eating Conus

Internal links
Proteins Encoded C6.24 precursor

External links
Ncbi
GenBank AF174230

Tools