Sequence 24 from patent US 6077934 (N01183) Nucleic Acid Card

General Information
Name Sequence 24 from patent US 6077934
Organism Unknown
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
atggggaaactgacaatactgg
Sequence translation ?

References
Jacobsen,R., Jimenez,E., Cruz,L.J., Olivera,B.M., Gray,W.R., Grilley,M., Watkins,M. and Hillyard,D.R. (2000) Contryphan peptides Patent: US 6077934 20-JUN-2000

Internal links
Proteins Encoded

External links
Ncbi
GenBank AR099613

Tools