Leo-A1, mRNA, partial sequence (N01253) Nucleic Acid Card

General Information
Name Leo-A1, mRNA, partial sequence
Organism Conus leopardus
Organism Diet vermivorous
Organism Clade
Organism Region Indo-Pacific
Notes

Sequence
c
ctcactttagatcgtgcatctgatgacactgatgtcgca
gccgagataatgtctggcctgatcgctcttgccatcgaca
gctgctgttccgattctgactgtaacgcgaaccatcccga
tatgtgcagt
taaagacgctgctgctccaggaccccctga
accacgacatgccgccctctgcctgacctgcttcactttg
cgtctctttgtgtcactagaactgaacaagccgatccact
agaattccacgttacctccgtattctgcaactacttggtt
ttgattgtctttcatttccagtcacacttgctgtcgttac
atcgtcaacatttaaacaagaacatgaggggtgtctgttc
aaccaacatcaggcaatgacaagggaaaaaagtctttgat
ctatccgaaaactgccacccgtcattctcttaaccagttt
tagatctgattaccattagagctttgtaccacataaaatc
aggtctatgtgtaatgtttctttcgtaaacttcgctgaaa
ttcttgagaaaaaaaaaaa
Sequence translation LTLDRASDDTDVAAEIMSGLIALAIDSCCSDSDCNANHPD
MCS

References
Remigio,E.A. and Duda,T.F. Jr. (2008) Evolution of ecological specialization and venom of a predatory marine gastropod. Mol. Ecol. 17:1156-1162

Internal links
Proteins Encoded Lp1.11 precursor

External links
Ncbi
GenBank EF467320

Tools