Conus abbreviatus four-loop conotoxin gene, partial cds. (N01266) Nucleic Acid Card

General Information
Name Conus abbreviatus four-loop conotoxin gene, partial cds.
Organism Conus abbreviatus
Organism Diet vermivorous
Organism Clade
Organism Region Indo-Pacific
Notes

Sequence
cattgtacttatcatcgacactgctgcgacctctattgca
ataaaacaaccaacgtatgtttggaaacg
tgatctggcgt
ctgatattccccttttgtgctctgtcctcttttg
Sequence translation HCTYHRHCCDLYCNKTTNVCLET

References
Duda,T.F. Jr. and Remigio,E.A. (2008) Variation and evolution of toxin gene expression patterns of six closely related venomous marine snails. Mol. Ecol. 17:3018-3032

Internal links
Proteins Encoded four-loop conotoxin

External links
Ncbi
GenBank EU404113

Tools