Sequence 291 from Patent EP1852440. (N01454) Nucleic Acid Card

General Information
Name Sequence 291 from Patent EP1852440.
Organism Conus ammiralis
Organism Diet molluscivorous
Organism Clade V
Organism Region Indo-Pacific
Notes

Sequence
atgttcaccgtgtttctgttggttgtcttggcaaccactg
tcgtttcctccacttcaggtcgtcgtgcatttcgtggcag
gaatgccgcagccaaagcgtctggactggtcggtctgact
gacaggagaccagaatgctgtagtgatcctcgctgtaact
cgactcatccagaactttgtggtggaagacgc
tgatgctc
caggaccctctgaaccacgacgt
Sequence translation MFTVFLLVVLATTVVSSTSGRRAFRGRNAAAKASGLVGLT
DRRPECCSDPRCNSTHPELCGGRR

References
Watkins, M., Hillyard, D.R., McIntosh, M.J., Jones, R.M. and Olivera, B.M. (2007) Alpha-conotoxin peptides Patent: EP 1852440-A 07-NOV-2007; University of Utah Research Foundation (US);

Internal links
Proteins Encoded Ai1.2 precursor

External links
Ncbi
GenBank FB300121

Tools