Sequence 130 from Patent EP1852440. (N01495) Nucleic Acid Card

General Information
Name Sequence 130 from Patent EP1852440.
Organism Conus dalli
Organism Diet molluscivorous
Organism Clade
Organism Region Eastern Pacific
Notes

Sequence
atgttcaccgtgtttctgttggttgtcttggcaaccaccg
tcgtttccttcacttcagatcgtgcatttcgtggcaggaa
tgccgcagccaaagagtctggcctggtcggtctgaccgac
aagacgcgaggatgctgttctcatcctgcctgtaacgtag
atcatccagaaatttgtggt
tgaagacgctgatgctccag
gaccctctgaaccacgacgt
Sequence translation MFTVFLLVVLATTVVSFTSDRAFRGRNAAAKESGLVGLTD
KTRGCCSHPACNVDHPEICG

References
Watkins, M., Hillyard, D.R., McIntosh, M.J., Jones, R.M. and Olivera, B.M. (2007) Alpha-conotoxin peptides Patent: EP 1852440-A 07-NOV-2007; University of Utah Research Foundation (US);

Internal links
Proteins Encoded Sequence 130 from Patent EP1852440.

External links
Ncbi
GenBank FB299960

Tools