MIL2-h allele, mRNA, partial cds (N01570) Nucleic Acid Card

General Information
Name MIL2-h allele, mRNA, partial cds
Organism Conus miliaris
Organism Diet vermivorous
Organism Clade XI
Organism Region Indo-Pacific
Notes

Sequence
tgcacgcctcccggtggagcctgtggtgtttattatcact
gctgcagcaattattgcattaccatcagctccacatgtag
a
taaagctggtctggcgtctgatattccccttccgtgatc
tatcctcttttg
Sequence translation CTPPGGACGVYYHCCSNYCITISSTCR

References
Duda,T.F. Jr. and Lee,T. (2009) Ecological release and venom evolution of a predatory marine snail at Easter Island. PLoS ONE 4

Internal links
Proteins Encoded MIL2-h (partial)

External links
Ncbi
GenBank FJ613520

Tools