Pu14.3 precursor, mRNA, complete cds (N01585) Nucleic Acid Card

General Information
Name Pu14.3 precursor, mRNA, complete cds
Organism Conus pulicarius
Organism Diet vermivorous
Organism Clade XIV
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccgtgtttctgctggttg
tcttggcaaccactgtcgattctttcaatgtagatcgtgc
atctgatgacagggattccgcagccatgcacacagagtat
gacgtgatcgctacggacaattgcataccctgtagtcatc
ccgcctgtggcatcaaccgtggaaaatgtcgt
tga
Sequence translation MGMRMMFTVFLLVVLATTVDSFNVDRASDDRDSAAMHTEY
DVIATDNCIPCSHPACGINRGKCR

References
Peng, C., Wu, X., Wang, Y., Shao, X., Chi, C. and Wang, C. (0) Identification and characterization of a new four-Cys conotoxin (framework 14) from the vermivorous Conus pulicarius, pu14a, a novel antagonist of nicotinic acetylcholine receptors Unpublished

Internal links
Proteins Encoded Pu14.3 precursor

External links
Ncbi
GenBank EU912019

Tools