Conus nux isolate P3 four-loop conotoxin gene, partial cds. (N01599) Nucleic Acid Card

General Information
Name Conus nux isolate P3 four-loop conotoxin gene, partial cds.
Organism Conus nux
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
ttgcctgactactggtgaatattgttggcttgctagttcc
tgctgcggctattcgtgcaccaacaacgtctgcttc
taaa
gctggtctggcgtctgacaacccccttctgtgctctatcc
tcttttg
Sequence translation LPDYW-ILLAC-FLLRLFVHQQRLL?

References
Duda,T.F. Jr., Bolin,M.B., Meyer,C.P. and Kohn,A.J. (2008) Hidden diversity in a hyperdiverse gastropod genus: discovery of previously unidentified members of a Conus species complex. Mol. Phylogenet. Evol. 49:867-876

Internal links
Proteins Encoded Nu6.2

External links
Ncbi
GenBank EU423402

Tools