Conus ebraeus O-superfamily conotoxin (E1) mRNA, E1b allele,partial cds. (N01625) Nucleic Acid Card

General Information
Name Conus ebraeus O-superfamily conotoxin (E1) mRNA, E1b allele,partial cds.
Organism Conus ebraeus
Organism Diet vermivorous
Organism Clade XI
Organism Region Indo-Pacific,Eastern Pacific
Notes

Sequence
cgtgttgatcatcgccgtgctgttcctgacggcctgtcaa
ctcactacagctgagacttactccagaggtaggcagaagc
atcgtgctcggaggtcaactgacaaaaactccaagtggac
cagggaatgcacagattccggcggagcctgtaatagtcat
gatcaatgctgcaacgagttttgcagtacggcgaccagga
catgtatttaa
actcgtggggcgcctgatatttccctttc
gtgatctatcctcttttg
Sequence translation RVDHRRAVPDGLSTHYS-DLLQR-AEASCSEVN-QKLQVD
QGMHRFRRSL--S-SMLQRVLQYGDQDMYL?

References
Duda,T.F. Jr., Chang,D., Lewis,B.D. and Lee,T. (2009) Geographic variation in venom allelic composition and diets of the widespread predatory marine gastropod Conus ebraeus. PLoS ONE 4

Internal links
Proteins Encoded Eb6.14 precursor

External links
Ncbi
GenBank FJ804531

Tools