Conus miliaris O-superfamily conotoxin (MIL3) mRNA, MIL3-f2 allele,partial cds. (N01626) Nucleic Acid Card

General Information
Name Conus miliaris O-superfamily conotoxin (MIL3) mRNA, MIL3-f2 allele,partial cds.
Organism Conus miliaris
Organism Diet vermivorous
Organism Clade XI
Organism Region Indo-Pacific
Notes

Sequence
tgcacgcatcccggtggagcctgtggtggtcatcatcact
gctgcagcctgttttgcaataccgcggccaatgcatgtaa
t
taaagctggtctggcgtctgatattccccttccgtgatc
tatcctcttttg
Sequence translation CTHPGGACGGHHHCCSLFCNTAANACN

References
Duda,T.F. Jr. and Lee,T. (2009) Ecological release and venom evolution of a predatory marine snail at Easter Island. PLoS ONE 4

Internal links
Proteins Encoded MIL3-f3 (partial)

External links
Ncbi
GenBank FJ716825

Tools