Cs1.2 gene, partial cds (N01676) Nucleic Acid Card

General Information
Name Cs1.2 gene, partial cds
Organism Conus cervus
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
gaatctgatggcgcgaatgccgaacccagcgccgaccagg
ctgccaggtccgcagtgaacaggccgcctggatgctgtaa
caatcctgcctgtggggcgaacagatgtgga
Sequence translation ESDGANAEPSADQAARSAVNRPPGCCNNPACGANRCG

References

Internal links
Proteins Encoded Cs1.2 precursor

External links
Ncbi
GenBank FJ937348

Tools