Sequence 12 from patent US 7101849 (N00017) Nucleic Acid Card

General Information
Name Sequence 12 from patent US 7101849
Organism Unknown
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
atcatcaaa
atgaaactgacgtgtgtggtgatcgtcgccg
tgctgctcctgacggcctgtcaactcatcacagctaatga
ctccagaggtacgcagaagcatcgtgccctgaggtcggac
accaaactctccatgtcgactcgctgcaagagtaaaggag
caaaatgttcaaagcttatgtatgactgctgcagcggttc
ttgcagcggcaccgtaggtagatgtggc
tgatccggcgct
tgatctcccccttctgtgctctatccttttctgcctgagt
cctccttacctgagagtggtcatgaaccactcatcaccta
ccccctggaggtctcaaagaactacttgaaataaagccgc
ttgcaaaaaaaaaaaaaaaaaa
Sequence translation MKLTCVVIVAVLLLTACQLITANDSRGTQKHRALRSDTKL
SMSTRCKSKGAKCSKLMYDCCSGSCSGTVGRCG

References
Drinkwater,R.D., Lewis,R.J., Alewood,P.F. and Nielsen,K.J. (2006) Omega.conotoxin peptides Patent: US 7101849 05-SEP-2006

Internal links
Proteins Encoded CVID precursor

External links
Ncbi
GenBank AR935345

Tools