Conus magus isolate MVIII superfamily conotoxin gene, complete cds. (N01708) Nucleic Acid Card

General Information
Name Conus magus isolate MVIII superfamily conotoxin gene, complete cds.
Organism Conus magus (Magus cone)
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
atgttcaccgtgtttctgttggttgtcttggcaaccactg
tcgtttccatcccttcagatcgtgcatctgatggcaggaa
tgccgtagtccacgagagagcgcctgagctggtcgttacg
gccaccacgaattgctgtggttataatccgatgacaatat
gccctccttgcatgtgcacttattcctgtccaccaaaaag
aaaaccaggccgcagaaacgactga
tgctccaggaccctc
tgaaccacgacgttcgagca
Sequence translation MFTVFLLVVLATTVVSIPSDRASDGRNAVVHERAPELVVT
ATTNCCGYNPMTICPPCMCTYSCPPKRKPGRRND-

References
Puillandre,N. and Olivera,B.M. (2010) Evolution of Conus Peptide Genes: Duplication and Positive Selection in the A-Superfamily. J Mol Evol

Internal links
Proteins Encoded MIVA precursor

External links
Ncbi
GenBank FJ868088

Tools