Cal1.4 precursor (N01771) Nucleic Acid Card

General Information
Name Cal1.4 precursor
Organism Conus californicus
Organism Diet piscivorous
Organism Clade Early
Organism Region Eastern Pacific
Notes

Sequence
cc
tttgacgatctgatgttactcctgtgctgccggcaagg
ccctgtctgcttcatccctttgaacgagtggccatgttcc
cgcatg
Sequence translation FDDLMLLLCCRQGPVCFIPLNEWPCSRM

References
Biggs,J.S., Watkins,M., Puillandre,N., Ownby,J.P., Lopez-Vera,E., Christensen,S., Moreno,K.J., Bernaldez,J., Licea-Navarro,A. and Olivera,B.M. (2010) Evolution of Conus peptide toxins: analysis of Conus californicus Reeve, 1844. Mol. Phylogenet. Evol. 56:1-12

Internal links
Proteins Encoded Cal1.4

External links
Ncbi
GenBank FJ959118

Tools