Conus vitulinus alpha-conotoxin Vt1.24 precursor, mRNA, complete cds. (N01831) Nucleic Acid Card

General Information
Name Conus vitulinus alpha-conotoxin Vt1.24 precursor, mRNA, complete cds.
Organism Conus vitulinus
Organism Diet vermivorous
Organism Clade
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccgtgtttctgttggttg
tcttggcaaccactgtcgtttcctttaccttagatcgtgc
atctgatggcgccaatgcagcagccgacctggtcgctcga
ggcattaggggaaactgctgtatgtttcatacctgtccca
ttgactattcacgtttttattgtccttga
Sequence translation MGMRMMFTVFLLVVLATTVVSFTLDRASDGANAAADLVAR
GIRGNCCMFHTCPIDYSRFYCP-

References

Internal links
Proteins Encoded Vt1.24 precursor

External links
Ncbi
GenBank HM211181

Tools