Conus victoriae alpha conotoxin Vc1.2 precursor, mRNA, complete cds. (N01835) Nucleic Acid Card

General Information
Name Conus victoriae alpha conotoxin Vc1.2 precursor, mRNA, complete cds.
Organism Conus victoriae
Organism Diet molluscivorous
Organism Clade V
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccgtgtttctgttggttg
tcttggcaaccaccgtcgttttcttcacttcagatcgtgc
atctgatggcaggaaagccgctgcgtctgacctgatcact
ctgaccatcaagggatgctgttctaatcctgcctgtatgg
tgaataatccacagatttgtggtcgacgacgctga
Sequence translation MGMRMMFTVFLLVVLATTVVFFTSDRASDGRKAAASDLIT
LTIKGCCSNPACMVNNPQICGRRR-

References
Safavi-Hemami,H., Siero,W.A., Kuang,Z., Williamson,N.A., Karas,J.A., Page,L.R., MacMillan,D., Callaghan,B., Kompella,S.N., Adams,D.J., Norton,R.S., and Purcell,A.W. (2011) Embryonic toxin expression in the cone snail Conus victoriae: primed to kill or divergent function? J. Biol. Chem. 286:22546-22557

Internal links
Proteins Encoded Vc1.2 precursor

External links
Ncbi
GenBank GU046308

Tools