Bt1.61 mRNA, complete cds. (N01914) Nucleic Acid Card

General Information
Name Bt1.61 mRNA, complete cds.
Organism Conus betulinus
Organism Diet vermivorous
Organism Clade X
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccgtgtttctgttggttg
tcttggcaaccactgtcgtttccttcacttcagatcgtgc
atctgatggcagaaatgcagcaggcaacgaaatgcctgac
tgggtcattcgtgccatcaagctaacatgctgttccgaat
taacctgtgccgggaattatccaaacatctgtggttga
Sequence translation MGMRMMFTVFLLVVLATTVVSFTSDRASDGRNAAGNEMPD
WVIRAIKLTCCSELTCAGNYPNICG-

References

Internal links
Proteins Encoded Bt1.61 precursor

External links
Ncbi
GenBank HQ857553

Tools