Sequence 42 from patent US 7101849 (N00020) Nucleic Acid Card

General Information
Name Sequence 42 from patent US 7101849
Organism Unknown
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
aactggaagaattcgcggccgcaggaat
Sequence translation ?

References
Drinkwater,R.D., Lewis,R.J., Alewood,P.F. and Nielsen,K.J. (2006) Omega.conotoxin peptides Patent: US 7101849 05-SEP-2006

Internal links
Proteins Encoded

External links
Ncbi
GenBank AR935348

Tools