Conus quercinus isolate QUER_17 alpha-conotoxin pseudogene, partial sequence. (N02265) Nucleic Acid Card

General Information
Name Conus quercinus isolate QUER_17 alpha-conotoxin pseudogene, partial sequence.
Organism Conus quercinus
Organism Diet vermivorous
Organism Clade VII
Organism Region Indo-Pacific
Notes

Sequence
ccgcagccgacagcaaagcggctgactagatcgctcagac
cgtcagggatccatgctgttctaatccttcctgtgcccag
actcatccagagatttgtcgccgaacgctgatgct
Sequence translation ?

References
Chang,D. and Duda,T.F. Jr. (2012) Extensive and continuous duplication facilitates rapid evolution and diversification of gene families. Mol. Biol. Evol. 29:2019-2029

Internal links
Proteins Encoded

External links
Ncbi
GenBank JF723463

Tools