Sa1.12 precursor (SANG_4) gene, partial cds. (N02285) Nucleic Acid Card

General Information
Name Sa1.12 precursor (SANG_4) gene, partial cds.
Organism Conus sanguinolentus
Organism Diet
Organism Clade
Organism Region Indo-Pacific
Notes

Sequence
cc
gcagccaacgccaaattgtctgagcggttggatccatg
ctgtagggagcctccctgtgcctcgacacatactgatatt
tgtaccagaaggcgttga
tgct
Sequence translation AANAKLSERLDPCCREPPCASTHTDICTRRR-

References
Chang,D. and Duda,T.F. Jr. (2012) Extensive and continuous duplication facilitates rapid evolution and diversification of gene families. Mol. Biol. Evol. 29:2019-2029

Internal links
Proteins Encoded Sa1.12 precursor

External links
Ncbi
GenBank JF723486

Tools