Dd1.3 precursor (DIAD_11) gene, partial cds. (N02296) Nucleic Acid Card

General Information
Name Dd1.3 precursor (DIAD_11) gene, partial cds.
Organism Conus diadema
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
ct
gcaggcaacgacaaagcgactgacctgatggctctgac
tgtcaggggatgctgttcccatcctgcctgtgctgggaat
aatccacatatctgcggctga
agacgctgatgct
Sequence translation AGNDKATDLMALTVRGCCSHPACAGNNPHICG-

References
Chang,D. and Duda,T.F. Jr. (2012) Extensive and continuous duplication facilitates rapid evolution and diversification of gene families. Mol. Biol. Evol. 29:2019-2029

Internal links
Proteins Encoded Dd1.3 precursor

External links
Ncbi
GenBank JF723386

Tools