UNVERIFIED: Conus virgo conotoxin Vi6.10-like mRNA, complete sequence. (N02369) Nucleic Acid Card

General Information
Name UNVERIFIED: Conus virgo conotoxin Vi6.10-like mRNA, complete sequence.
Organism Conus virgo
Organism Diet vermivorous
Organism Clade XIII
Organism Region Indo-Pacific
Notes

Sequence
atgtcgggattgggattcttggtgctaaccaatgggcttc
ttgtgtccatggccaccagtcatcaggatagtggagagaa
gcggccccctcaatggcacgcaatcaacgtcagacggaga
agatcaatcattcggagagcagtagatgaggcgtgcaatg
agtactgtgaggagcggaacaagaactgctgcggcacccg
ggatggagaacccgtattgcacaggcatgcctcggatagt
ttctgtgctttgtctcattcattcttttgtcttttcaaaa
ataaaagaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaaa
Sequence translation ?

References

Internal links
Proteins Encoded

External links
Ncbi
GenBank JX000447

Tools