Conus flavidus A-conotoxin peptide precursor Fla1.3 (Fla1.3) mRNA, complete cds. (N02376) Nucleic Acid Card

General Information
Name Conus flavidus A-conotoxin peptide precursor Fla1.3 (Fla1.3) mRNA, complete cds.
Organism Conus flavidus
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
gtgaagcagcatcgtcgacaatttcaggtggggataatac
aagatacgcagaacaaggaagcagagaatctgagaaaata
atc
atgggcatgcggatgatgttcaccatgcttctgttgg
ttgtcttggcaaccactgtcgtttccttcacgttagatca
tgcatttgatggcaggaatatcgcagccaacaacaaagcg
actgacctgatggctctgcctgtcaggggatgctgttccg
atcctccctgtagacacaagcaccaagatctttgtggctg
a
agacgctgatgctccaggaccctctgagccacgacatgc
tgccctctgcctggcctgcttcactttccgtctctttgtg
ccactagaactgaacaacttgatccactagactcccacgt
ttccttcgtactctgaaactactcggatttgattgtctct
aatttctagtcacacttgctgtcattacatcatataaatt
taaacaagaacatgaggggtgtctgttcaaacaaaaccag
gcaatgacaagggaaaaagtctccgatctatttgaaaact
gtcacccgtcattctcttaaccagttttagaactgattac
caatagagcttttgtaccgcataaattcaggtctttgtgt
aatgtttcttttacaaacgtcgatgaaattcttgggaaaa
aaaaaaagctgaaaatgtgggaagcacttttggttgtctg
acaacttgtgatcatgtctctttccagtgagtctcactgt
gatctctgttgtgtgtttttcatcacctgttaagcaacgc
aaagaggttgtccataatcaggaaagcaaaagacaaagaa
ctgctcaagaatttcaggaaatagatagggcaggggaaaa
acagacctatgggaaatgataaaaacaacagataaaagaa
attgacattacctacttgtttcatggttgatgactttttt
ttccgaatatcttttgtggacattaatggcagtctcacct
catcccatgccataattttcctcctatccagagatttgcg
tggaaatt
Sequence translation MGMRMMFTMLLLVVLATTVVSFTLDHAFDGRNIAANNKAT
DLMALPVRGCCSDPPCRHKHQDLCG-

References

Internal links
Proteins Encoded Fla1.3 precursor

External links
Ncbi
GenBank JX499076

Tools