Conus flavidus A-conotoxin peptide precursor Fla1.6 (Fla1.6) mRNA, complete cds. (N02378) Nucleic Acid Card

General Information
Name Conus flavidus A-conotoxin peptide precursor Fla1.6 (Fla1.6) mRNA, complete cds.
Organism Conus flavidus
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
gcggaccagacggacgtgaaacagcatcaccggcaatttc
aggtggggacagcgcaagccacgtcgaacagggtagcaga
gagtctgagataataacc
atgggcatgcggatgatgttca
ctgtgtttctgttggttgccttggccaccactgtcgcttc
cttcactttagatcatgcatctaatggcaggaatgctgca
gccgacgacaatatgtctgactggatcgctcaggccctca
agcgttgctgcggcaatccaccctgtgcccatgtaaattg
tcgtggaagacgctga
tgctccaggaccctctgaaccacg
acatgctgccctctgcctgacctgcttcactttccgtctc
tttgtgccactagaactgaacaacccgatccactagactt
ccacgttacccctgtataatcaaactacttggttttgatt
gtttttttttttaaatttctacccacacttgctgtcaata
catcgtccaaaatttaaacaagaacatgaggggtgtctcc
tcaacaaaatcaggtaatggcaagggaaaaagtctttgat
ctatctgataactgtcatctgtcattctcttaaccagtgt
tacaacggattaccacaagcgctttgtatcacagaacatc
aggtctttgtgtaatgtttctttttgcgaactttcgctga
cattcttgagaagaaagctcaacatgttggtagcgttttt
gattgtctgacgacttgtgatcatgtcctttttcactgag
tctaactgcaacctctgtgtgtttttcttcacctctgaag
cattgcaaagaggttgtccataatcaggaaagcaaacgac
aaagaactgctcgagaatttcaggttatagatagggtgag
gggaaaaacagacgtatgggaaatgatgaaaacggtagat
aaaaggaattggaacaattacatac
Sequence translation MGMRMMFTVFLLVALATTVASFTLDHASNGRNAAADDNMS
DWIAQALKRCCGNPPCAHVNCRGRR-

References

Internal links
Proteins Encoded Fla1.6 precursor

External links
Ncbi
GenBank JX499078

Tools