Conus flavidus A-conotoxin peptide precursor Fla1.7a (Fla1.7) mRNA, partial cds. (N02379) Nucleic Acid Card

General Information
Name Conus flavidus A-conotoxin peptide precursor Fla1.7a (Fla1.7) mRNA, partial cds.
Organism Conus flavidus
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
atgggcatgcggatgatgttcaccgtgtttctgttggttg
tcttgtcaaccactgtcgtttccctccctgtagatcatgc
atctaatggcagggatgccgcagccgacagcaatgcggct
gaccagatcgctcagaccgccagggatccatgctgttcta
atccttcctgtgcccagactcatccagagatttgtcgccg
aatgctccagaaccctctgaaccacgacatgtcgccctct
gcc
Sequence translation MGMRMMFTVFLLVVLSTTVVSLPVDHASNGRDAAADSNAA
DQIAQTARDPCCSNPSCAQTHPEICRRMLQNPLNHDMSPS
A

References

Internal links
Proteins Encoded Fla1.7 precursor

External links
Ncbi
GenBank JX499079

Tools