Conus rattus A superfamily conotoxin Rt1.2 precursor, mRNA, complete cds. (N02430) Nucleic Acid Card

General Information
Name Conus rattus A superfamily conotoxin Rt1.2 precursor, mRNA, complete cds.
Organism Conus rattus
Organism Diet vermivorous
Organism Clade
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccatgtttctgttggttg
tcttgtcaaccactgtcgtttccctccctgtagatcatgc
atctaatggcagggatgccgcagccgacagcaatgcggct
gaccagatcgctcagacggccagggatccatgctgttcta
atccttcctgtgcccagactcatccagagatttgtcgccg
aatgctccagaaccctctgaaccacgacatgtcaccctct
gcctga
Sequence translation MGMRMMFTMFLLVVLSTTVVSLPVDHASNGRDAAADSNAA
DQIAQTARDPCCSNPSCAQTHPEICRRMLQNPLNHDMSPS
A-

References

Internal links
Proteins Encoded Rt1.2 precursor

External links
Ncbi
GenBank JX293444

Tools