Conus quercinus A superfamily conotoxin Qc1.7 precursor, mRNA, complete cds. (N02432) Nucleic Acid Card

General Information
Name Conus quercinus A superfamily conotoxin Qc1.7 precursor, mRNA, complete cds.
Organism Conus quercinus
Organism Diet vermivorous
Organism Clade VII
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccgtgtttctgttggttg
tcttggcaaccgctgtcgtttccttcagttcagatcgtgc
atctcatggcaggaatgccgcagccaaagtgtttgaccgg
atcgctctgatcgccacacgcgaatgctgtgccaatcctc
aatgttgggcgaagaattgtcgctga
Sequence translation MGMRMMFTVFLLVVLATAVVSFSSDRASHGRNAAAKVFDR
IALIATRECCANPQCWAKNCR-

References

Internal links
Proteins Encoded Qc1.17 precursor

External links
Ncbi
GenBank JX293446

Tools