Cal12.1.2h mRNA, partial cds (N00251) Nucleic Acid Card

General Information
Name Cal12.1.2h mRNA, partial cds
Organism Conus californicus
Organism Diet piscivorous
Organism Clade Early
Organism Region Eastern Pacific
Notes

Sequence
gacgtctgcgattcgctggtaggcggacgctgtatccaca
atggctgttggtgtgagcgaagtgcacctcatggtaattg
ctgcaacactggcggctgtgtatggtggtggtgtcccggg
accaaatgggac
taa
Sequence translation DVCDSLVGGRCIHNGCWCERSAPHGNCCNTGGCVWWWCPG
TKWD

References
Elliger,C.A., Richmond,T.A., Lebaric,Z.N., Pierce,N.T., Sweedler,J.V. and Gilly,W.F. (2011) Diversity of conotoxin types from Conus californicus reflects a diversity of prey types and a novel evolutionary history. Toxicon 57:311-322

Internal links
Proteins Encoded Cal12.1.2h

External links
Ncbi
GenBank EF644191

Tools