Conus consors mRNA for A superfamily CcTx precursor, biomaterial CH070619AA-AC. (N02554) Nucleic Acid Card

General Information
Name Conus consors mRNA for A superfamily CcTx precursor, biomaterial CH070619AA-AC.
Organism Conus consors
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
gsattcacctgaccagctgcagaccagacggacgtgaaac
agcatagccggcaagtggagatagtacaagacacgcagaa
caaagaagcagagagtctgagaaaatagcc
atgggcatgc
ggatgatgttcaccgtgtttctgttggttgtcttggcaac
cactgtcgtttccatcccttcagatcgtgcatctgatggc
aggaatgccgcagtccacgagagagcgccttggctggtcc
cttcgcaaatcacgacttgctgtggmtataatccggggac
aatgtgcccttcttgcatgtgcactaatacctgctaa
aaa
aatggctgatgctccaggaccctctgaaccacgacatgcc
gccctctgcctgacctgcttcactgtccgtctctttgtgc
cactagaactgtacaactcgatccactagactcccacgtt
acctccgtattctcaaactacttggatttgattgtcctta
atatctgctcatacttgctgttattacatcgtccaaaatt
taaacaagaacatgggtgtcttttgaaacaaaaccaggca
atgataagggaaaaagtctccaatctatccgaaaactgtc
acccgtcattctcttaaccagttttagaactgattaccac
tkgagcttttgtaccacatcaaatccggtctatgtgtaat
gtctctttgcaaacttcgctgaaattcttgagaaaaaaag
ctcaaaatgtgggaagtgctattggttatctgacaactcg
tcatcatgttctttttcagtgagtctaactgcaacttttg
tgtctttttcttcacttggtaagcaacacaaagttgtcca
taatcaggaaagcaaaagataaagaactgcttgagyattt
caggctatagatggggtaagggaaaaacagagctatggga
aatggtgaaaacaacagataaaagaaatttaacaatacct
acttgtttcatggttgatgattttttgttctgaataatgt
ttgtggagatgaatggcagtgtctcttccccccatgccat
tagttttttgtttgtttgtttgtttttttgtctttctttc
tttatccaagatttgctgaatattatgaactgacaataaa
ctgtcataggcaccagtgaaaaaaaaaaaaaaaaaacaaa
aaaaacaaatgtcggcc
Sequence translation MGMRMMFTVFLLVVLATTVVSIPSDRASDGRNAAVHERAP
WLVPSQITTCC?YNPGTMCPSCMCTNTC-

References

Internal links
Proteins Encoded CcTx precursor

External links
Ncbi
GenBank HE856373

Tools