Conus consors mRNA for O superfamily CnVIIA precursor, biomaterial CH070619AA-AC. (N02557) Nucleic Acid Card

General Information
Name Conus consors mRNA for O superfamily CnVIIA precursor, biomaterial CH070619AA-AC.
Organism Conus consors
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
tccattacggccgggcaaaaccatcatcaaa
atgaaactg
acgtgtgtggtgatcgtcgccgtgctgctcctgacggcct
gtcaactcatcacaactgatgactccagaggtacgcagaa
gcatcttgccctgaggtcggacaccaaactctccatgtcg
actcgctgcaagggtaaaggagcaccatgtacaaggctta
tgtatgactgctgccacggttcttgcagcagcagcaaagg
tagatgtggc
tgatccggcgcctgatcttcccccttctgt
gctctatccttttctgcctgagtcctccttacctgagagt
ggtcatgaaccactcatcacctgctcccctggaggcctca
gaggagctacaatgaaataaaagccgcattgaaaaaaaaa
aaaaaaaacaaaaaaaagaaaaa
Sequence translation MKLTCVVIVAVLLLTACQLITTDDSRGTQKHLALRSDTKL
SMSTRCKGKGAPCTRLMYDCCHGSCSSSKGRCG

References

Internal links
Proteins Encoded CnVIIA precursor

External links
Ncbi
GenBank HE856383

Tools