Conus consors mRNA for O superfamily CnVIIB precursor, biomaterial CH070619AA-AC. (N02558) Nucleic Acid Card

General Information
Name Conus consors mRNA for O superfamily CnVIIB precursor, biomaterial CH070619AA-AC.
Organism Conus consors
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
gagatgttcctgttttgtgcatgtgactaggggctgttgt
tggagctaggacctsgggagaggactgacggcaggcgggg
ataaaagcaggcgacagtgacgcgtgtrwcacatcgtctg
cctgatccttgcacggcgagcctgacttcatctttcttcc
ctgcctcctttggcatcaccaaaaccatcatcaga
atgaa
actgacgtgtgtggtgatcgtcgccgtgctgctcctgacg
gcctgtcaactcatcacagctgatgactccagaggtacgc
araggcatcgtgccctgaggtcggacaccaaactctccat
gtcaactcgctgcaaaggtaaaggagcatcatgtcgtagg
acttcgtatgactgctgcaccggttcttgcagatcaggta
aatgtggctga
tccagcgtctgatcttcccccttctgtgc
tctatccttttctgcctgagtcctccttacctgagagtgg
tcatgaaccactcatcacctgctcctctggaggcctcaga
ggagctacattgaaataaaagccgcattgcaatgaaaaaa
aaaaaaaaacaaaaaaaaaaaa
Sequence translation MKLTCVVIVAVLLLTACQLITADDSRGT?RHRALRSDTKL
SMSTRCKGKGASCRRTSYDCCTGSCRSGKCG-

References

Internal links
Proteins Encoded CnVIIB precursor

External links
Ncbi
GenBank HE856384

Tools