Conus consors mRNA for O superfamily CnVIID precursor, biomaterial CH070619AA-AC. (N02560) Nucleic Acid Card

General Information
Name Conus consors mRNA for O superfamily CnVIID precursor, biomaterial CH070619AA-AC.
Organism Conus consors
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
gaacaataacgtaactaagacctaagaatccttgcgcggc
gaacctgacttcatctttcttccctgcctcctttggcatc
accaaaaccatcatcaaa
atgaaactgacgtgtgtggtga
tcgtcgccgtgctgctcctgacggcctgtcaactcatcac
agctgatgactccagaggtacgcagaggcatcgtgccctg
aggtcggacaccaaactctccatgtcgactcgctgcaagg
gtaaaggagcatcatgtagtaggaccatgtataactgctg
cagcggttcttgcaacagaggtaaatgtggctga
tccagc
rccaa
Sequence translation MKLTCVVIVAVLLLTACQLITADDSRGTQRHRALRSDTKL
SMSTRCKGKGASCSRTMYNCCSGSCNRGKCG-

References

Internal links
Proteins Encoded CnVIID precursor

External links
Ncbi
GenBank HE856386

Tools