Conus geographus omega-conotoxin precursor GVIA mRNA, complete cds (N00261) Nucleic Acid Card

General Information
Name Conus geographus omega-conotoxin precursor GVIA mRNA, complete cds
Organism Conus geographus (Geography cone)
Organism Diet piscivorous
Organism Clade II
Organism Region Indo-Pacific
Notes

Sequence
aaaaccatcatcaaa
atgaaactgacgtgtgtggtgatcg
tcgccgtgctgctcctgacggcctgtcaactcatcacagc
tgatgactccagaggtacgcagaagcatcgtgccctgggg
tcgaccaccgaactctccttgtcgactcgctgcaagtcac
ccggatcttcatgttcaccgactagttataattgctgcag
gtcttgcaatccatacaccaaaagatgttacggc
taatcc
agcgcctgatcttccctgctctgagtcctccttacctgag
agtggtcatgaaccactcatcacctacttctctaggcggt
tcggaggagctacattgaaataaaagccgcattgc
Sequence translation MKLTCVVIVAVLLLTACQLITADDSRGTQKHRALGSTTEL
SLSTRCKSPGSSCSPTSYNCCRSCNPYTKRCYG

References
Colledge,C.J., Hunsperger,J.P., Imperial,J.S. and Hillyard,D.R. (1992) Precursor structure of omega-conotoxin GVIA determined from a cDNA clone Toxicon 30:1111-1116

Internal links
Proteins Encoded GVIA precursor

External links
Ncbi
GenBank M84612, AB910845

Tools