Sequence 8 from patent US 5591821 (N00268) Nucleic Acid Card

General Information
Name Sequence 8 from patent US 5591821
Organism Unknown
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
actcgctgcaagggtaaaggagcaccatgtcgtaagacta
tgtatgactgctgcagcggttcttgcggcaggagaggtaa
atgtggctga
Sequence translation ?

References
Olivera,B.M., Hillyard,D.R., Imperial,J.S. and Monje,V.D. (1997) Omega-conotoxin peptides Patent: US 5591821 07-JAN-1997

Internal links
Proteins Encoded

External links
Ncbi
GenBank I33457

Tools