Sequence 52 from patent US 5633347 (N00273) Nucleic Acid Card

General Information
Name Sequence 52 from patent US 5633347
Organism Unknown
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
tctgcgaatgggcatgcggatgatgtt
Sequence translation ?

References
Olivera,B.M., Cruz,L.J., Hillyard,D.R., McIntosh,J.Michael. and Santos,A.O. (1997) Conotoxin peptides Patent: US 5633347 27-MAY-1997

Internal links
Proteins Encoded

External links
Ncbi
GenBank I43895

Tools