omega-CgTx-MVIIC=omega-conotoxin [Conus magus, venom ducts, mRNA Partial, 90 nt] (N00276) Nucleic Acid Card

General Information
Name omega-CgTx-MVIIC=omega-conotoxin [Conus magus, venom ducts, mRNA Partial, 90 nt]
Organism Conus magus (Magus cone)
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
actcgctgcaagggtaaaggagcaccatgtcgtaagacta
tgtatgactgctgcagcggttcttgcggcaggagaggtaa
atgtggc
tga
Sequence translation TRCKGKGAPCRKTMYDCCSGSCGRRGKCG

References
Hillyard,D.R., Monje,V.D., Mintz,I.M., Bean,B.P., Nadasdi,L., Ramachandran,J., Miljanich,G., Azimi-Zoonooz,A., McIntosh,J.M., Cruz,L.J. et al. (1992) A new Conus peptide ligand for mammalian presynaptic Ca2+ channels Neuron 9:69-77

Internal links
Proteins Encoded MVIIC precursor

External links
Ncbi
GenBank S40826

Tools