Conus geographus mRNA for G040_VD_Contryphan_precursor_conopeptide, complete cds. (N02800) Nucleic Acid Card

General Information
Name Conus geographus mRNA for G040_VD_Contryphan_precursor_conopeptide, complete cds.
Organism Conus geographus (Geography cone)
Organism Diet piscivorous
Organism Clade II
Organism Region Indo-Pacific
Notes

Sequence
atggggaaactgacaatactggttcttgttgctgctgtac
tgttgtcgacccaggccatggttcaaggtgacggagacca
acctgcagctcgtaatgcagtgccaagagacgataaccca
gatggaccgagtgcaaagttcatgaatgttcaacgtcggt
ctggatgtccgtgggagccgtggtgtggctaa
Sequence translation ?

References
Dutertre,S., Jin,A.H., Vetter,I., Hamilton,B., Sunagar,K., Lavergne,V., Dutertre,V., Fry,B.G., Antunes,A., Venter,D.J., Alewood,P.F. and Lewis,R.J. (2014) Evolution of separate predation- and defence-evoked venoms in carnivorous cone snails Nat Commun 5:3521

Internal links
Proteins Encoded

External links
Ncbi
GenBank AB910805

Tools