Amz1.2 (N02941) Nucleic Acid Card

General Information
Name Amz1.2
Organism Conus andremenezi
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
ATGCGTTGCCTTGCTTTCCTGGTCGTCACTCTACTCTTGT
TCACTGCTATGGCAACAACAGGAGCATCCAATCGTGTGAA
TGCTGCAGCCAATGGCAAAGCATCTGACTTGATCTCTCTG
GCCGTCAGGAACGGTTGCTGTAAGTATCCTCCCTGTCGGT
GGAATAATCCGCAACTTTGTCGCCCCAGTTGA
Sequence translation MRCLAFLVVTLLLFTAMATTGASNRVNAAANGKASDLISL
AVRNGCCKYPPCRWNNPQLCRPS-

References
Li,Q., Barghi,N., Lu,A., Fedosov,A.E., Bandyopadhyay,P.K., Lluisma,A.O., Concepcion,G.P., Yandell,M., Olivera,B.M. and Safavi-Hemami,H. (2017) Divergence of the Venom Exogene Repertoire in Two Sister Species of Turriconus. Genome Biol Evol 9:2211-2225

Internal links
Proteins Encoded Amz1.2 precursor

External links
Ncbi
GenBank MF576543

Tools