Conantokin-SuE precursor incomplete (N03053) Nucleic Acid Card

General Information
Name Conantokin-SuE precursor incomplete
Organism Conus sulcatus
Organism Diet
Organism Clade
Organism Region Indo-Pacific
Notes

Sequence
GCCAGAGGCGAAGAAGAATGTTCAGAGGCTATAGGAAGAA
AATAA
Sequence translation ARGEEECSEAIGRK-

References
Platt,R.J., Curtice,K.J., Twede,V.D., Watkins,M., GruszczyƄski,P., Bulaj,G., Horvath,M.P. and Olivera,B.M. (2014) From molecular phylogeny towards differentiating pharmacology for NMDA receptor subtypes. Toxicon 81:67-79

Internal links
Proteins Encoded Conantokin-SuE

External links
Ncbi
GenBank

Tools