Novel omega-conotoxin peptides (N00307) Nucleic Acid Card

General Information
Name Novel omega-conotoxin peptides
Organism Conus catus
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
atcatcaaa
atgaaactgacgtgtgtggtgatcgtcgccg
tgctgctcctgacggcctgtcaactcatcacagctaatga
ctccagaggtacgcagaagcatcgtgccctgaggtcggac
accaaactctccatgtcgactcgctgcaagagtaaaggag
caaaatgttcaaagcttatgtatgactgctgcagcggttc
ttgcagcggcaccgtaggtagatgtggc
tgatccggcgct
tgatctcccccttctgtgctctatccttttctgcctgagt
cctccttacctgagagtggtcatgaaccactcatcaccta
ccccctggaggtctcaaagaactacttgaaataaagccgc
ttgcaaaaaaaaaaaaaaaaaa
Sequence translation MKLTCVVIVAVLLLTACQLITANDSRGTQKHRALRSDTKL
SMSTRCKSKGAKCSKLMYDCCSGSCSGTVGRCG

References
Drinkwater,R.D., Lewis,R.J., Alewood,P.F. and Nielsen,K.J. (2002) Novel omega-conotoxin peptides Patent: JP 2002512254-A 2 23-APR-2002

Internal links
Proteins Encoded CVID precursor

External links
Ncbi
GenBank BD241823

Tools