Alpha-conotoxin peptides (N00366) Nucleic Acid Card

General Information
Name Alpha-conotoxin peptides
Organism Conus purpurascens
Organism Diet piscivorous
Organism Clade III
Organism Region Eastern Pacific
Notes

Sequence
tctgaaggcaggaatgctgaagccatcgacaacgccttag
accagagggatccaaagcgacaggagccggggtgctgtag
gcatcctgcctgtgggaagaacagatgtggaagacgctga
tgctccaggaccctctgaaccacgacg
t
Sequence translation SEGRNAEAIDNALDQRDPKRQEPGCCRHPACGKNRCGRR-
CSRTL-TTT

References
Watkins,M., Olivera,B.M., Hillyard,D.R., Mcintosh,M.J. and Jones,R.M. (2002) Alpha-conotoxin peptides JP 2002534996-A 11 22-OCT-2002

Internal links
Proteins Encoded P1.9 precursor

External links
Ncbi
GenBank BD261453

Tools