Conus tessulatus clone TsMLKM-012 conotoxin scaffold III/IV precursor, mRNA, complete cds (N00045) Nucleic Acid Card

General Information
Name Conus tessulatus clone TsMLKM-012 conotoxin scaffold III/IV precursor, mRNA, complete cds
Organism Conus tessulatus
Organism Diet vermivorous
Organism Clade XVI
Organism Region Indo-Pacific
Notes

Sequence
gaggttcgtg
atgttgaaaatgggagtggtgctattcgtc
tttctggtcctgtttcccctrgcaacgctycagctggatg
cagatcarcctgtagaacgatatgcggagaacaaacagct
cgtcagcccatacgaaaggaggcaaatcataytgcatgct
ctggggcagcgagactgctgcgtgatgccatggtgtgacg
gagcttgtgattgctgcgtgtcgtcc
tgaacatccatagc
gctgtgctgggcggctttrtccaacaacgacagcgtttgt
tgattycatatatcattgcgcccacgcctccttgtctaar
aat
Sequence translation MLKMGVVLFVFLVLFP?AT?QLDAD?PVERYAENKQLVSP
YERRQII?HALGQRDCCVMPWCDGACDCCVSS

References
Conticello,S.G., Gilad,Y., Avidan,N., Ben-Asher,E., Levy,Z. and Fainzilber,M. (2001) Mechanisms for evolving hypervariability: the case of conopeptides Mol. Biol. Evol. 18:120-131

Internal links
Proteins Encoded Ts3.5 precursor

External links
Ncbi
GenBank AF214945

Tools