Conus purpurascens isolate purpurascens-1 four-loop conotoxin preproprotein mRNA, partial cds (N00457) Nucleic Acid Card

General Information
Name Conus purpurascens isolate purpurascens-1 four-loop conotoxin preproprotein mRNA, partial cds
Organism Conus purpurascens
Organism Diet piscivorous
Organism Clade III
Organism Region Eastern Pacific
Notes

Sequence
t
gtggtgatcgtcgcggtgctgttcctgacggcctgtcaa
ctcatcacagctgatgactccagacgtacgcagaagcatc
gtgccctgaggtcgaccaccaaactctccctgtcgactcg
ctgcaggattcccaatcaaaaatgttttcagcatctggac
gactgctgctctcgcaaatgcaatagatttaataaatgtg
tc
tgatcttcccccttctgtgctgtatccttttctg
Sequence translation VVIVAVLFLTACQLITADDSRRTQKHRALRSTTKLSLSTR
CRIPNQKCFQHLDDCCSRKCNRFNKCV

References
Duda,T.F. Jr. and Palumbi,S.R. (0) Convergent evolution of venoms and feeding ecologies among polyphyletic piscivorous Conus species

Internal links
Proteins Encoded PVIIA precursor

External links
Ncbi
GenBank AF480312

Tools