Conus imperialis mRNA for Conus peptide (N00464) Nucleic Acid Card

General Information
Name Conus imperialis mRNA for Conus peptide
Organism Conus imperialis
Organism Diet vermivorous
Organism Clade XVII
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcaccgtgtttctgttggttg
tcttggcaaccactgttgttcccatcactttagctagtgc
aactgatggaaggaatgctgcagccaacgccagagtgtct
cccgtgatctctaaatccagtaagaaatggtgtcatccga
atccttacactgtgggg
taa
Sequence translation MGMRMMFTVFLLVVLATTVVPITLASATDGRNAAANARVS
PVISKSSKKWCHPNPYTVG

References
Lu,B.S., Yu,F., Wang,J.H., Zhao,D., Zhao,S.Q. and Huang,P.T. (0) Cloning of alpha-conotoxin sequences from Conus textile venom duct

Internal links
Proteins Encoded putative peptide precursor

External links
Ncbi
GenBank AJ011793

Tools