Conus leopardus alpha conotoxin lp1.4 mRNA, complete cds (N00490) Nucleic Acid Card

General Information
Name Conus leopardus alpha conotoxin lp1.4 mRNA, complete cds
Organism Conus leopardus
Organism Diet vermivorous
Organism Clade
Organism Region Indo-Pacific
Notes

Sequence
atgggcatgcggatgatgttcatcatgtttatgttggttg
tcttggcaacgactgtcgtttccttcacttcagatcgtgc
acttgatgccatgaatgctgcagccagcaagaaagcgtct
cgcctgatcgctctggccgtcaggggatgctgttcccatc
ctgcctgtagtggaaatcatcaagaactttgtgatggaag
acgc
tgatgatccaggaccctctgaaccacgac
Sequence translation MGMRMMFIMFMLVVLATTVVSFTSDRALDAMNAAASKKAS
RLIALAVRGCCSHPACSGNHQELCDGRR

References

Internal links
Proteins Encoded Lp1.4 precursor

External links
Ncbi
GenBank AY580324

Tools