omega-conotoxin MVIID (N00531) Nucleic Acid Card

General Information
Name omega-conotoxin MVIID
Organism Conus magus (Magus cone)
Organism Diet piscivorous
Organism Clade I
Organism Region Indo-Pacific
Notes

Sequence
tcgactcgctgccagggtagaggagcatcatgtcgtaaga
ctatgtataactgctgcagcggttcttgcaacagaggtag
atgtggc
tga
Sequence translation STRCQGRGASCRKTMYNCCSGSCNRGRCG

References
Monje,V.D., Haack,J.A., Naisbitt,S.R., Miljanich,G., Ramachandran,J., Nasdasdi,L., Olivera,B.M., Hillyard,D.R. and Gray,W.R. (1993) A new Conus peptide ligand for Ca channel subtypes Neuropharmacology 32:1141-1149

Internal links
Proteins Encoded MVIID precursor

External links
Ncbi
GenBank S69322

Tools