Sequence 84 from patent US 6797808 (N00545) Nucleic Acid Card

General Information
Name Sequence 84 from patent US 6797808
Organism Unknown
Organism Diet
Organism Clade
Organism Region
Notes

Sequence
atgttcaccgtgtttctgttggttgtcttggcaaccactg
tggtttccttcacttcagatcgtgcgtctgaaggcaggaa
tgctgcagccaaggacaaagcgtctgacctggtggctctg
acagtcaggggatgctgtgccattcgtgaatgtcgcttgc
agaatgcagcgtattgtggtggaatatac
tgatgctccag
gaccctctgaaccacgacg
Sequence translation MFTVFLLVVLATTVVSFTSDRASEGRNAAAKDKASDLVAL
TVRGCCAIRECRLQNAAYCGGIY

References
Watkins,M., Olivera,B.M., Hillyard,D.R., McIntosh,J.M. and Jones,R.M. (2002) Alpha-conotoxin peptides JP 2002534996-A 11 22-OCT-2002

Internal links
Proteins Encoded Ca1.2 precursor

External links
Ncbi
GenBank AR584815

Tools